NONCODE
Browse ncRNA
Browse nucleotide
Browse lncRNAs
Browse expression
Browse function
Details of ncRNA
ncRNA n297584
detailed information on ncRNA n297584
Go to: General  Description  Reference  Sequence 
General Information
ncid: n297584
accession number in NCBI: AK003173 (from 1 to 675)
NCBI URL: http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=AK003173
Original URL: http://fantom3.gsc.riken.jp/db/annotate/main.cgi?masterid=1100001I12
Genome Browser:http://www.noncode.org/cgi-bin/hgTracks?db=mm9&position=chr15%3A38570697-38589594
Description
name: Mouse noncoding transcript
alias: N/A
class: mRNAlike lncRNA
pfclass: Miscfunction_mRNAlike
molecular mechanism: unknown
celluar role: unknown
celluar location: cytoplasm
length: 675
spliced: yes
organism: Mus musculus
Taxonomic group: Mus musculus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Mammalia Euteleostomi Vertebrata Craniata Chordata Metazoa Eukaryota
specific feature: N/A
note: mRNA-like ncRNA from FANTOM3 (Functional Annotation of the mouse: http://fantom3.gsc.riken.jp)
CPC Score: -0.7451220
Expression Profile
Affymetrix Microarrays Expression Profile FANTOM customer microarray expression profile
NO affy microarray expression profile
RNA-seq expression profiles
NO RNA-seq expression profiles
Predicted Function
No function predicted based on the coding-noncoding co-expression network
Mapping
Mapping Location 1
species:Mus musculus
genome:mm9
chr: chr15
strand:-
start: 38570697
end: 38589594
Sequence
1CGGTATCCGATTCTGGAAAAGAACTTGGCTGCATTCTAGCTCTGTCCTGAAATTTTGTTT
61CAAATTTTAAGGTTCAGGTCAAAGTGATGGACTAAGTTATTTGGCAAGGGATTTCATGAC
121AGTATAACATCCAGCCTGTAGAATGGTTACTGCTTGCTGAATTTAGCTTTGAATCAGGAA
181GAAGAAATCTATGAAATAAGCAGTTTGATTGAAGGATCTTGAACACACTTAAAACAACAG
241ATAAGGTAGATGGAGAGAAAGCAGGCATTCCATTGATACCTCATTTACAGAAATACAAAT
301TGAAGGAACTCTGGCCAACCCGACCATGGCGACCATGGCGACCAAGGTCTAACAAACCAA
361GAACAATGTACAAGAATGCCGATCTACCTGCATATTTGGCAGCCTTATACGATATAATAA
421TTTGGCTTCAGTCTCCCAAATATAAAGATGTCCATCCTGATGCTTATGTCCGAGTAAGTG
481CTCAGAAGTGAAGTCACCCAGCAAAGAGCTTTGTGTGCACCCCCAGAGTACAACTTTATC
541TGCAGAAGATTTAACTCAGCCATGTGCTTCAGTCCATTCTGTTTTTGATGAAAAGCCATG
601GAGACTAAGAGCTTTGACAGTTCCACTGTTACCTGGTACAACATGGACAAAAATTAAACA
661TTAACCCAGTCCTCG
Related ncRNAs
Not available in the current release of NONCODE
References
refid: r2853
authors: Carninci,P. and Hayashizaki,Y.
title: High-efficiency full-length cDNA cloning
journal: Meth. Enzymol. 303, 19-44 (1999)
medline:
pubmed: 10349636
refid: r2854
authors: Carninci,P., Shibata,Y., Hayatsu,N., Sugahara,Y., Shibata,K., Itoh,M., Konno,H., Okazaki,Y., Muramatsu,M. and Hayashizaki,Y.
title: Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes
journal: Genome Res. 10 (10), 1617-1630 (2000)
medline:
pubmed: 11042159
refid: r2855
authors: Shibata,K., Itoh,M., Aizawa,K., Nagaoka,S., Sasaki,N., Carninci,P., Konno,H., Akiyama,J., Nishi,K., Kitsunai,T., Tashiro,H., Itoh,M., Sumi,N., Ishii,Y., Nakamura,S., Hazama,M., Nishine,T., Harada,A., Yamamoto,R., Matsumoto,H., Sakaguchi,S., Ikegami,T., Kashiwagi,K., Fujiwake,S., Inoue,K., Togawa,Y., Izawa,M., Ohara,E., Watahiki,M., Yoneda,Y., Ishikawa,T., Ozawa,K., Tanaka,T., Matsuura,S., Kawai,J., Okazaki,Y., Muramatsu,M., Inoue,Y., Kira,A. and Hayashizaki,Y.
title: RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer
journal: Genome Res. 10 (11), 1757-1771 (2000)
medline:
pubmed: 11076861
refid: r2856
authors: Kawai,J., Shinagawa,A., Shibata,K., Yoshino,M., Itoh,M., Ishii,Y., Arakawa,T., Hara,A., Fukunishi,Y., Konno,H., Adachi,J., Fukuda,S., Aizawa,K., Izawa,M., Nishi,K., Kiyosawa,H., Kondo,S., Yamanaka,I., Saito,T., Okazaki,Y., Gojobori,T., Bono,H., Kasukawa,T., Saito,R., Kadota,K., Matsuda,H., Ashburner,M., Batalov,S., Casavant,T., Fleischmann,W., Gaasterland,T., Gissi,C., King,B., Kochiwa,H., Kuehl,P., Lewis,S., Matsuo,Y., Nikaido,I., Pesole,G., Quackenbush,J., Schriml,L.M., Staubli,F., Suzuki,R., Tomita,M., Wagner,L., Washio,T., Sakai,K., Okido,T., Furuno,M., Aono,H., Baldarelli,R., Barsh,G., Blake,J., Boffelli,D., Bojunga,N., Carninci,P., de Bonaldo,M.F., Brownstein,M.J., Bult,C., Fletcher,C., Fujita,M., Gariboldi,M., Gustincich,S., Hill,D., Hofmann,M., Hume,D.A., Kamiya,M., Lee,N.H., Lyons,P., Marchionni,L., Mashima,J., Mazzarelli,J., Mombaerts,P., Nordone,P., Ring,B., Ringwald,M., Rodriguez,I., Sakamoto,N., Sasaki,H., Sato,K., Schonbach,C., Seya,T., Shibata,Y., Storch,K.F., Suzuki,H., Toyo-oka,K., Wang,K.H., Weitz,C., Whittaker,C., Wilming,L., Wynshaw-Boris,A., Yoshida,K., Hasegawa,Y., Kawaji,H., Kohtsuki,S. and Hayashizaki,Y.
title: Functional annotation of a full-length mouse cDNA collection
journal: Nature 409 (6821), 685-690 (2001)
medline:
pubmed: 11217851
refid: r2857
authors: Okazaki,Y., Furuno,M., Kasukawa,T., Adachi,J., Bono,H., Kondo,S., Nikaido,I., Osato,N., Saito,R., Suzuki,H., Yamanaka,I., Kiyosawa,H., Yagi,K., Tomaru,Y., Hasegawa,Y., Nogami,A., Schonbach,C., Gojobori,T., Baldarelli,R., Hill,D.P., Bult,C., Hume,D.A., Quackenbush,J., Schriml,L.M., Kanapin,A., Matsuda,H., Batalov,S., Beisel,K.W., Blake,J.A., Bradt,D., Brusic,V., Chothia,C., Corbani,L.E., Cousins,S., Dalla,E., Dragani,T.A., Fletcher,C.F., Forrest,A., Frazer,K.S., Gaasterland,T., Gariboldi,M., Gissi,C., Godzik,A., Gough,J., Grimmond,S., Gustincich,S., Hirokawa,N., Jackson,I.J., Jarvis,E.D., Kanai,A., Kawaji,H., Kawasawa,Y., Kedzierski,R.M., King,B.L., Konagaya,A., Kurochkin,I.V., Lee,Y., Lenhard,B., Lyons,P.A., Maglott,D.R., Maltais,L., Marchionni,L., McKenzie,L., Miki,H., Nagashima,T., Numata,K., Okido,T., Pavan,W.J., Pertea,G., Pesole,G., Petrovsky,N., Pillai,R., Pontius,J.U., Qi,D., Ramachandran,S., Ravasi,T., Reed,J.C., Reed,D.J., Reid,J., Ring,B.Z., Ringwald,M., Sandelin,A., Schneider,C., Semple,C.A., Setou,M., Shimada,K., Sultana,R., Takenaka,Y., Taylor,M.S., Teasdale,R.D., Tomita,M., Verardo,R., Wagner,L., Wahlestedt,C., Wang,Y., Watanabe,Y., Wells,C., Wilming,L.G., Wynshaw-Boris,A., Yanagisawa,M., Yang,I., Yang,L., Yuan,Z., Zavolan,M., Zhu,Y., Zimmer,A., Carninci,P., Hayatsu,N., Hirozane-Kishikawa,T., Konno,H., Nakamura,M., Sakazume,N., Sato,K., Shiraki,T., Waki,K., Kawai,J., Aizawa,K., Arakawa,T., Fukuda,S., Hara,A., Hashizume,W., Imotani,K., Ishii,Y., Itoh,M., Kagawa,I., Miyazaki,A., Sakai,K., Sasaki,D., Shibata,K., Shinagawa,A., Yasunishi,A., Yoshino,M., Waterston,R., Lander,E.S., Rogers,J., Birney,E. and Hayashizaki,Y.
title: Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs
journal: Nature 420 (6915), 563-573 (2002)
medline:
pubmed: 12466851
refid: r2858
authors: Carninci,P., Kasukawa,T., Katayama,S., Gough,J., Frith,M.C., Maeda,N., Oyama,R., Ravasi,T., Lenhard,B., Wells,C., Kodzius,R., Shimokawa,K., Bajic,V.B., Brenner,S.E., Batalov,S., Forrest,A.R., Zavolan,M., Davis,M.J., Wilming,L.G., Aidinis,V., Allen,J.E., Ambesi-Impiombato,A., Apweiler,R., Aturaliya,R.N., Bailey,T.L., Bansal,M., Baxter,L., Beisel,K.W., Bersano,T., Bono,H., Chalk,A.M., Chiu,K.P., Choudhary,V., Christoffels,A., Clutterbuck,D.R., Crowe,M.L., Dalla,E., Dalrymple,B.P., de Bono,B., Della Gatta,G., di Bernardo,D., Down,T., Engstrom,P., Fagiolini,M., Faulkner,G., Fletcher,C.F., Fukushima,T., Furuno,M., Futaki,S., Gariboldi,M., Georgii-Hemming,P., Gingeras,T.R., Gojobori,T., Green,R.E., Gustincich,S., Harbers,M., Hayashi,Y., Hensch,T.K., Hirokawa,N., Hill,D., Huminiecki,L., Iacono,M., Ikeo,K., Iwama,A., Ishikawa,T., Jakt,M., Kanapin,A., Katoh,M., Kawasawa,Y., Kelso,J., Kitamura,H., Kitano,H., Kollias,G., Krishnan,S.P., Kruger,A., Kummerfeld,S.K., Kurochkin,I.V., Lareau,L.F., Lazarevic,D., Lipovich,L., Liu,J., Liuni,S., McWilliam,S., Madan Babu,M., Madera,M., Marchionni,L., Matsuda,H., Matsuzawa,S., Miki,H., Mignone,F., Miyake,S., Morris,K., Mottagui-Tabar,S., Mulder,N., Nakano,N., Nakauchi,H., Ng,P., Nilsson,R., Nishiguchi,S., Nishikawa,S., Nori,F., Ohara,O., Okazaki,Y., Orlando,V., Pang,K.C., Pavan,W.J., Pavesi,G., Pesole,G., Petrovsky,N., Piazza,S., Reed,J., Reid,J.F., Ring,B.Z., Ringwald,M., Rost,B., Ruan,Y., Salzberg,S.L., Sandelin,A., Schneider,C., Schonbach,C., Sekiguchi,K., Semple,C.A., Seno,S., Sessa,L., Sheng,Y., Shibata,Y., Shimada,H., Shimada,K., Silva,D., Sinclair,B., Sperling,S., Stupka,E., Sugiura,K., Sultana,R., Takenaka,Y., Taki,K., Tammoja,K., Tan,S.L., Tang,S., Taylor,M.S., Tegner,J., Teichmann,S.A., Ueda,H.R., van Nimwegen,E., Verardo,R., Wei,C.L., Yagi,K., Yamanishi,H., Zabarovsky,E., Zhu,S., Zimmer,A., Hide,W., Bult,C., Grimmond,S.M., Teasdale,R.D., Liu,E.T., Brusic,V., Quackenbush,J., Wahlestedt,C., Mattick,J.S., Hume,D.A., Kai,C., Sasaki,D., Tomaru,Y., Fukuda,S., Kanamori-Katayama,M., Suzuki,M., Aoki,J., Arakawa,T., Iida,J., Imamura,K., Itoh,M., Kato,T., Kawaji,H., Kawagashira,N., Kawashima,T., Kojima,M., Kondo,S., Konno,H., Nakano,K., Ninomiya,N., Nishio,T., Okada,M., Plessy,C., Shibata,K., Shiraki,T., Suzuki,S., Tagami,M., Waki,K., Watahiki,A., Okamura-Oho,Y., Suzuki,H., Kawai,J. and Hayashizaki,Y.
title: The transcriptional landscape of the mammalian genome
journal: Science 309 (5740), 1559-1563 (2005)
medline:
pubmed: 16141072
refid: r2859
authors: Katayama,S., Tomaru,Y., Kasukawa,T., Waki,K., Nakanishi,M., Nakamura,M., Nishida,H., Yap,C.C., Suzuki,M., Kawai,J., Suzuki,H., Carninci,P., Hayashizaki,Y., Wells,C., Frith,M., Ravasi,T., Pang,K.C., Hallinan,J., Mattick,J., Hume,D.A., Lipovich,L., Batalov,S., Engstrom,P.G., Mizuno,Y., Faghihi,M.A., Sandelin,A., Chalk,A.M., Mottagui-Tabar,S., Liang,Z., Lenhard,B. and Wahlestedt,C.
title: Antisense transcription in the mammalian transcriptome
journal: Science 309 (5740), 1564-1566 (2005)
medline:
pubmed: 16141073