| General Information |
| ncid: n5 |
| uniqid: u5 |
| accession number in NCBI: AB009049 (from 42080 to 42167) |
| NCBI URL: http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=AB009049 |
| Description |
| name: U24 |
| alias: |
| class: snoRNA |
| pfclass: RNA_modification_methylation |
| molecular mechanism: basepair |
| celluar role: constituent |
| celluar location: nucleolus |
| chromosome: 5 |
| strand: 1 |
| length: 88 |
| spliced: no |
| organism: Arabidopsis thaliana (thale cress) |
| Taxonomic group: thaliana Arabidopsis Brassicaceae Brassicales eurosids II rosids core eudicots eudicotyledons Magnoliophyta Spermatophyta Tracheophyta Embryophyta Streptophyta Viridiplantae Eukaryota |
| specific feature: |
| note: . |
| References |
refid: r4
authors: Sato,S., Kaneko,T., Kotani,H., Nakamura,Y., Asamizu,E., Miyajima,N. and Tabata,S.
title: Structural analysis of Arabidopsis thaliana chromosome 5. IV. Sequence features of the regions of 1,456,315 bp covered by nineteen physically assigned P1 and TAC clones
journal: DNA Res. 5 (1), 41-54 (1998)
medline: 98290546
pubmed: 9628582 |
| Sequence |
| 1 | GGCCGGTGATGTAATCAAAATATTTGCTACTCTTGATGAAGAATTTCTTCAGTTGATGAT | | 61 | ATTTACCACCAAGATCTCTGAGGCCTTT |
|
| Related ncRNAs |
| ncRNA with the same uniqid: n2219, n2234 |
| ncRNA with the same accession number: none |
