An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT000182.2

General info


NONCODE TRANSCRIPT IDNONBTAT000182.2
NONCODE Gene IDNONBTAG000122.2
Chromosomechr1
Start Site22822843
End Site22823702
Strand+
Exon Number2
CNCI Score-0.0004096
Length503
AssemblybosTau6
Other transcript VersionsNONBTAT000182.1(old version)

Sequence


>NONBTAT000182.2
GAAAATCATGCATTGATGCTTTCCTAAAGCTGGGAATGTTAACATAAGGCACTCCTCATTTCTGAGTGTCCTGCCCATTCCCACCTCCAGAACCTGACAAATCTACTTACCAGCATGTCAAGTCACTTCTCTTGAAGAATAAACACCAGAAAGTAGGAGGCTCAAGAGTGACAGAAATTTAGACCGAAATTCAGAAACGGACATCTAAAGTTAATTACAGCCCTGTCATTCACAGTTATCACTTCAGCTTTCATTTTTTCTATCAAAACTAACATATGTCTCCTACTTTTTTCTCTGCGAGATTAATGTCCTCTTATTCTTAGTTTTAAATTTCTCTGAGTATCAGTCCATGGTCACTTTTTGGAAAATAATCTTAAACATGAAATCTTGAAATGCATTTTTGTTTGGCAAATTTTATAATGAAAAAACAAAATATTGCTACATGAAAGTCATTAGTCTATATACTATCTTTCTAATACTGATCTTGTAATATAAATCCTATA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198730