An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT000320.2

General info


NONCODE TRANSCRIPT IDNONBTAT000320.2
NONCODE Gene IDNONBTAG000231.2
Chromosomechr1
Start Site41514563
End Site41515373
Strand+
Exon Number1
CNCI Score-0.0737280
Length810
AssemblybosTau6
Other transcript VersionsNONBTAT000320.1(old version)

Sequence


>NONBTAT000320.2
GAAAATTACCAGAAAAAATAATAGCAACTACAAGCGCTAGTATTCTATTACTAGTACTCTGTTTTAGAAAAATAAATGATATAAAGTTTGTGGATATGTTTTCCCACATTTATTTTGGACATGAGGGTAGTAATACATAAGTTACCTTTGAATAAAACATTGTCCTGTTTTACCACAGATTATACACAGGTTATATAATCCCAGAATTTAAACATTTGCTCAAGTAAGAATTTCCTCCATCCCACCAACACTATTACAGATTTATTCAAGTGTTAGAAATAGTCCAGAAAAAAATATAAGCCAATCTAGCACCTAGTAAGATCATGTGGAAAACTATTTGAATTTTTATTCCTCATCCTGAAACAAAAAAATATAAGGAACTCTCAAGAACAAAGCAGGACGTATTCTCTGTTATTTTGAATTCTGTTCCTGGCTAAATATTATTTTTAAATTCCTACTCTTGAAAACTTATAAAACATTGCTGGAAAAAAGGTTCTAATAATAATCTTAAAATATTCATTATACTTCCTTTTTACTGTTTTGTACTGTTCTCTTTATTTTTGAAATGTTGCTATATATTCATTTTTACTAGTTTTATAGCTTTGAATATTTTAGGTTAATCTGGGTCACATTTCTAATAGAAGTTTTTTAAAACTCCTCATGTCCCTTTACCGTCTAAATTGGAGCCATCTTGCCATTCACATTGACAGGAAGCACAGTACAGATGGAAATGAACATTGTGATTTGAAAGGTATTGGGACCACACTGTAAACTCCTATCCTTCAATGTACGTCGCTTGAATATAACTTT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198133