An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT001059.2

General info


NONCODE TRANSCRIPT IDNONBTAT001059.2
NONCODE Gene IDNONBTAG000756.2
Chromosomechr1
Start Site94209163
End Site94209864
Strand-
Exon Number1
CNCI Score-0.0004096
Length701
AssemblybosTau6
Other transcript VersionsNONBTAT001059.1(old version)

Sequence


>NONBTAT001059.2
TAAAGTTATAATCTAGCAGTCAAGCCTATGTAGGGCCTGGGTAAAATGTTAAAGTTTGATATATCTCAGGGAGCACTGCCATTTGGATAGGTTTCCAATTTCTGACTCTCTTGTTTATCCCAGTTGTTGATTAAAATGGGTCATGATTTCTGTCATCGGTTATCCCATTGTAAACATACAACTTTAATATTGAAAGGAGTCGGTACAGATGGCTCCCATGATAATTCCTAACTCGTACATTATTTGATTTAATTTCATTTGGAATGTCAGTTTTAAGCACTGAGCACAAATGAAATTTTTATATGAGACTCCTTATTCATCATTAGGACTAAACAGCATGTATAGTTCATACAGGTAGCTCTGGGTTTTTCATTACTACAACATTTCTGTGAAGTACTCATTCTAGCTCTGAAAGTGATTTTCAGATCATTTATTCATGTCTTCACAACTATAGAAGCCACACTAGTAATGTCAGTGGTTAATTGAAATCATGGATCATGTCTTAGTTTGAAAATGTCTCTACAGCTTTTGTCTATAATAAAACCAACTAAGGTTTTGGATTGGAGAAAATCATAATATAAATTAAAAGTGTTTCTCTCCTTAATAAAAATATATTTAAGATAGTGTTTCAGTATGGCTTAATTTTACTTTGTTGTTGTTGTCTCACTTTGCACGGCAATGAAGCCTGAAATACTTCAGGG

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198602