An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT001696.2

General info


NONCODE TRANSCRIPT IDNONBTAT001696.2
NONCODE Gene IDNONBTAG001210.2
Chromosomechr10
Start Site2897935
End Site2898791
Strand+
Exon Number1
CNCI Score-0.0004096
Length856
AssemblybosTau6
Other transcript VersionsNONBTAT001696.1(old version)

Sequence


>NONBTAT001696.2
GGATCTTTAAGGTAGACTATTAAAAATGAAAACTTCCACAAGGAGACAAATAAGTTATAGTTAAAATACTGGCAAAAATCTCTATGGTTTATACAGTTAAAATAGAGAGGAAAATATCAAGAAGAACATTTGAAAGTATAAATAGATCAGGGGCCAGAAGTGGACTTTGCTTGTTCTAAATTAGTTGAGAACCAGCCTTTGTGGGTTTTTAAAGAAAAGTACTGGGGGCAATGACACTGGCCCATGTCCTCAGCCCCTCTCCATGCAGCTCTGGTCCTGTGCTCTAGTCCAGCAAACTTCCTTTGAAGTATTCTCGAAGTGAGAGACTGGTTCTATGTAAGATGAAATTGACTCAGAAGTTTTTTCAACTGCCCAGAGAAATTAATACCTTCAGAAGGAGCTTGAGGACACTGTCAGAATTAAAAAGAACTTGGTGACAATTTGACAATGAAAAGTCACTTTTGAAATTTCAGAAGAGCCAGACTCTATGAAGATTTAAAGTGATCCATTGGAGGTTGTTTAAAATGCAAAATTCACTTTAATTTTGAAAGTGAATTGAAGTTCTTCAACGGTGTTCCTTGTAAAAGTCACTGGTTTGCATCCTACTGAACCCCAAGATACAACAAGGCCAATTTATTTCTTCTCTGCCTTCCTTCCTGTCTCTGTTATATCTAAACCCTTAGCACAGTATCTAGTACATAGTTAACTGGTATGAAATATACATTAAATAAGTACTGTAACAATGCTCAGTTTAATTGCCAAACACAGATTGGAGATTGGAAAAAGTAGTATATATTACATAGTCATGTACTTCAGAGATATAAAAATTCTAAATAGCTGTGATTACTCATGAGTT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH199145