An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT003156.2

General info


NONCODE TRANSCRIPT IDNONBTAT003156.2
NONCODE Gene IDNONBTAG002233.2
Chromosomechr11
Start Site14945498
End Site14945721
Strand+
Exon Number1
CNCI Score-0.0004096
Length223
AssemblybosTau6
Other transcript VersionsNONBTAT003156.1(old version)

Sequence


>NONBTAT003156.2
GAAGTTATTGTGTTTGAGTTTACAGTTGTGAATTGGAGGGAGAAAAAACACCCAGAATGAGTGTTAGCAAAATGTTGATAAGCTTCTTAACATTCCTTTTAAATGCTCTAAGTGTTCATATTCTAAAACTGTGGAAGAACATGATAATAAACTATAGCTTGAAATGTTTCTTAAAAACGTCCTGAAACATCTTTTGATATTGCCTCAGAATTAATATAAAATA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198957