An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT003376.2

General info


NONCODE TRANSCRIPT IDNONBTAT003376.2
NONCODE Gene IDNONBTAG002387.2
Chromosomechr11
Start Site37087956
End Site37088699
Strand+
Exon Number1
CNCI Score-0.1720320
Length743
AssemblybosTau6
Other transcript VersionsNONBTAT003376.1(old version)

Sequence


>NONBTAT003376.2
CAGCTTGAATTGCCGTTGCTTCTGTGGCCTCACCTTCCCATCTTCCATCCAATCTCCCACTCACCCAGCCAGTTCATAAATAATTGGCCAGCACTTAACTTCTAGGTACCTTGCTGGGAGTTGAGAAATATAAGGACATTGTGATGGAGACTTGAACTTAAGAGTTTGTGTCCTGCTGATGGTTAGTAAGTAGATGTTTTGAAATTATGAAACAGTCTTACAGTGATAGGGTAGAGGTGTATGAGAAGCCTAGGAGGGAGGACATAGGTGGGCTGCCTAACTCAGACCGGGTGGTGGTGGTGGAGGAAGCACCAGGTGTGGCTTCCGGGATGAGGTAACAGCTAGCATTTGTGGGAAGAGCAAAGAGTTGTTCTAGGCTGTAGTTTGGAGGTGAGACCAGAGTGTGCCTTTTCCTTCACGAGTTGTAAGACTTGAGGAGAAGACTATTGAAACCAGGCTGGAGAGCTGGGCTGGGCCCTCACAGATGTTCTCATTTCTCTTCACAGGGTTCTGGGCGTTATTCAGAAGGCATATGGATTTTTTATTCTGAAGGTTGGGGGCATTTGGTGGATTTTAGTTGTGGGAATCAAGTGATTAGAATTACATATTAGAAAGGTCCCTCTGGCGGCAGTGTAAGGGGAGTGGGTTAGGGATTGAAATCAGAGGTGAGGCTCTGGAATGAGAAGCTATTGCTTGAGCCAATTTGAGATTTTTCAGGAGGTGCAGCAAACCAGGGGGCCTGC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH199524