An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT005177.2

General info


NONCODE TRANSCRIPT IDNONBTAT005177.2
NONCODE Gene IDNONBTAG003660.2
Chromosomechr13
Start Site25354887
End Site25355220
Strand+
Exon Number1
CNCI Score-0.0004096
Length333
AssemblybosTau6
Other transcript VersionsNONBTAT005177.1(old version)

Sequence


>NONBTAT005177.2
AAAAGAAATTTGCGGGGAAGAAAAGTGGTGTATATCTGAGAAAGATAAAAATTGAGAAAATGTAATTTTTGGTGGAGCAACCCTGCCGATTGACAGAAGCATGTGTCATAACAAATTACGTGTTGTATTTAAAGGATATATTATTTGTCTATCAGTGTATATGTGAGTGTGTGTTTAATAACCTACCAGAGGCCTGTGAATAAAGAATATGATAGGATTGAAAGCATCAGTATAAAAAAATTTTTCATTCTCAGAAATTTCAAATAATACTGGATATATCAAAGGGAAACAAACAATAGTCATCTAAATTTGAGCGTGATGGAAAACAACAGT

Isoforms

Transcript ID
NONBTAT005175.2

Data Sources

Source NameOld Id
PMID22880061EH198520