An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT005228.2

General info


NONCODE TRANSCRIPT IDNONBTAT005228.2
NONCODE Gene IDNONBTAG003701.2
Chromosomechr13
Start Site29295638
End Site29295887
Strand-
Exon Number1
CNCI Score-0.0004096
Length249
AssemblybosTau6
Other transcript VersionsNONBTAT005228.1(old version)

Sequence


>NONBTAT005228.2
TCCTTAGCCATTTGAATCTTGGATCCAAATTCTTTTGACTATTAAAACCATTTTTTACAAATTAAGGTTATTTGGTTTTTATAAGTTTTTTAAAAATACAAATAACTTTACATGATATATGTAACTCTTATATATATATATTTTTCACCCTCTGGGAAAAAATATATAACCTCCCGCTCTAGTTCTTTAATCCTTTGGATTATTGTGTATCCTTCCAGAAATTGTCCATACAGATGCAACATCTTTACT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198525