An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT007926.2

General info


NONCODE TRANSCRIPT IDNONBTAT007926.2
NONCODE Gene IDNONBTAG005455.2
Chromosomechr16
Start Site47313065
End Site47313424
Strand-
Exon Number1
CNCI Score-0.0004096
Length359
AssemblybosTau6
Other transcript VersionsNONBTAT007926.1(old version)

Sequence


>NONBTAT007926.2
GGAAAGTTTTACAATACTGGAATCTACCTAGTCAATAATACATGAAATTTGGGATTCATAAAAGGAAATAGTGGTGAAAATCTCCCCAAATAAGTTTTTATTCTAGAATGGGATGACAGACCTCCCGGAGCACTGGGTATCCCATAGGTGTGGTATTCTGAAATACAACCCGGGGCATATATATTGTCAAATAATAAAGTATTATGAAACCAATCAGCTGTGAGCTCCCCACTTGGCAGTTTGGAAGTAAAACCCTTTCTCCTTTACAAGGCCAAGTGACTCTTAATTCCTCCCAGGAGATTTCACGTTAAAATGTGTTCACTGCCAGCTGACAAAAGAGGCGAGTCCAGATTTATTAC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH199649