An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT008323.2

General info


NONCODE TRANSCRIPT IDNONBTAT008323.2
NONCODE Gene IDNONBTAG005711.2
Chromosomechr17
Start Site4639496
End Site4639823
Strand-
Exon Number1
CNCI Score-0.1118208
Length327
AssemblybosTau6
Other transcript VersionsNONBTAT008323.1(old version)

Sequence


>NONBTAT008323.2
GCTGGCACTACATCCTGGTGCTACTGTTCGATGTTAGCACCGAAAACCAGCCCGAATACGAATGGGCGTCTCCAACAGCTGTCCCCACAGCTCTCCTCTGTGTGCGCTGATCACAGCATTTATCACAGTCTTTGACTGATGACTCACTCGTCTACCTGTTCACCTAGTCTCCAGATCCCTAAGGAAAATAGGCATCTTGTCCATCTTTAAACGCCCAGTCCTAGCACAGTGACTAGTCCTACAGAGAAGAAGTGAAATGAATACTAAATAAATAAATGATTACCTGAAATGATAACGATTTTCTCAGACTTAGTTTCAAACCCATCT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH195960