An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT008598.2

General info


NONCODE TRANSCRIPT IDNONBTAT008598.2
NONCODE Gene IDNONBTAG005913.2
Chromosomechr17
Start Site42948408
End Site42948820
Strand+
Exon Number1
CNCI Score-0.0004096
Length412
AssemblybosTau6
Other transcript VersionsNONBTAT008598.1(old version)

Sequence


>NONBTAT008598.2
TTCTGGAATTCCAAGTCACAGTCTTTCCCTCTTTTTGATTTTCTATATGTATTCTTAAGCCAGGAAGTAAAAGAATCCATAATCTATTAATAAGATTTTATACTGCAGGTAAAAATACCACTCAATTCTATCATCAATAATTTACTTTAGTCCATTAATATACACTTCTTTGTATATGAGACAGATGTTGTGAGTCAAAATGCCTTTAAAAAAATTTTAAAGCCTTTTAAAAGTTGAGAATGAAAATAGTAAGGAAGACATACATTAATATATTCCACATTAACAGTATAAAGGATAATTAAATACATCTGATCTATTCCATCACTAGTAGTGATGTAAGGCACAAAAATGATTTGCATTATTCTCTATTTGAACTCTTCATTATACAAAAGAGTGAATAACAACTCAGAGC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH196594