An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT010231.2

General info


NONCODE TRANSCRIPT IDNONBTAT010231.2
NONCODE Gene IDNONBTAG006848.2
Chromosomechr19
Start Site42662916
End Site42663352
Strand-
Exon Number1
CNCI Score-0.0081920
Length436
AssemblybosTau6
Other transcript VersionsNONBTAT010231.1(old version)

Sequence


>NONBTAT010231.2
CTGTTGAGTTCTGTTTTACTTTCAGAAGAATGTTCTCACATTCAAATAATTAAGAATCTTTAATACATTTTAGGGGCTTCCTGTCTTTGAATTTAACCCTCTTTTGGACTGATGGTCGGGGACTCCATTTGATCTCATAATATTCCGAGACCATGCATGTATTAAAATTATAATTCTTCACTCTGTCCATTCCTGTTTTTATTGGGCACTGTTACTGACTGAACCATGTGACACATGATCCCTGAAGCAGCCTCCCTAAAGTCTGGAGGGTCCAGGCATGTGGAAGGTGACCTTAGCCAGAGGAGGCACATGGAGATGCTCCCGGTGAGGTTGTCCACCTGACGTTGGCAGTGCAATGGTTATCCCTGAACATACTACAGTATTCTAGCTCCACTAGAGCGTGTTTTTTTTACCAGATCTATCTAAATTGCCCGGC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198558