An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT010882.1

General info


NONCODE TRANSCRIPT IDNONBTAT010882.1
NONCODE Gene IDNONBTAG007259.1
Chromosomechr2
Start Site28587730
End Site28588599
Strand-
Exon Number1
CNCI Score-0.4385920
Length869
AssemblybosTau6
Other transcript VersionsNONBTAT010882.2

Sequence


>NONBTAT010882.1
AAAGCTCACCTCTAAGCAAGTCAGCCTGGGCTTCCTGCAGTGTGCAGCAATCTCATCTTCACACAGAGAAAGGATGAAGGGGTGCCTCGTCTAGACAGACATTTTTAAATCAGTCAGGAAGACACATTTGTTACCATTTGAGCATTTTTCAATATTCTGATGTGGGTGTGCTTAAGAGGTCTTGATGTCAACTCAGACATCTTGGAATTTAGAAAAAGCCTTCAGATTTATTTAATGATATTCATAAATTTTGCTCTGTATCTGAGTGTCAAATTCCTATACAGAACTTGAAAAGCTCTCTTAGATAAGTGTTGGCCTTTTTTCTTTTTTCCAAACTGCCTCTGGAGGAATTAGGAAACAGAATAGATGTTCTATAGTCAGCAACTCTATTGCATTATTCTTTTGAAAGAGTGAACTTGAGACTTATTATATAACCAGTGTTTTAAACAAAATTACAGAGTATCCTGAATTGCTTAAGCTCCATCTCTAATTTAACAGTGAACATATTTAAATGAAGATGAGCTAAAGGGTTTGGTAGTCATGGCAACATGATATGAAAATATACCACGTCATTCAAGTCTATTAGAAAAAAACATTTTCATTGCAAAGGTTTTTGTTGCTACTTTAAATACTGACTGTAGAAGAAAAAAGAAAAGAAGATGAAAGAATAGATGAGCCATGAAATATTTTAATTTTTTTGTTACAAGAATGGTAGCTTGAAAATAATGTGATCTAAATTCTAAATAAATTTAGCTGCAAAGTTGATATTAAAAATAAAGACTATGAGAAAATAAACAGATATCAAATCTGCTGCTTGACAAAAATGTATTAAATCTACTTCCTGCAGGTAAGCTTTTAGAAGGGAAAAG

Isoforms

Transcript ID
NONBTAT010881.1

Data Sources

Source NameOld Id
PMID22880061EH199193