An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT011360.2

General info


NONCODE TRANSCRIPT IDNONBTAT011360.2
NONCODE Gene IDNONBTAG007606.2
Chromosomechr2
Start Site84329738
End Site84330543
Strand+
Exon Number2
CNCI Score-0.0004096
Length373
AssemblybosTau6
Other transcript VersionsNONBTAT011360.1(old version)

Sequence


>NONBTAT011360.2
GCTAATTCCTTTAGATCAAAATATACACTATTTTATTATATCAGCCTTTAGCATTTTGGTTTAATGTTGTTGATTAGATTTACAAGTAACTTGATAGGACTGTAACATACTAGGATAAAGGTAAACAAAACTTTATGACAAAGAAGTCTGGAAGGATACAAAGAATTTTCAAAAATACTGCTGAAAAAAATACCAGTGTAAGTGGAAGGTGGAAGTTGGGGCATGGCTTTGATAAAGCTAAGACTTAGTTTTAAAAAAATTCATTAGAGCGTCTCTAAATTTTTACACTTAACATTTGTTTGTTGTTTGTTTAAGTATTAAAAGCTGGGTAAAGGAACAGGGAGGCTAAGGCTTTAAATCATAAAATAACTGC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198295