An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT011414.2

General info


NONCODE TRANSCRIPT IDNONBTAT011414.2
NONCODE Gene IDNONBTAG007643.2
Chromosomechr2
Start Site88419110
End Site88419466
Strand-
Exon Number1
CNCI Score-0.0004096
Length356
AssemblybosTau6
Other transcript VersionsNONBTAT011414.1(old version)

Sequence


>NONBTAT011414.2
GTTTTCATAATGGGCATAGCAAAGATTGGTCAGGACTTATGTAACCCAGCTTATCTATAAAAATGTACTCATGTGACCAAAAATATCGATTCATATGAACAAAGAGTTTAGTTAAGAAACCAGTGTTTTCTTATATCTTACATAATACAATGTTATAATTTGCTGCTATTTTCCTTTTTTTACTTGTAACCCCTGGTGGATATTAAAACGTACCCATTTGCAGTTTAAACGAACAGAATTAAAATCAGTTATGTTTTTCTGTCTTAACTTATTAAAAGGAAGTTTCCTGTTGTGACTAATAAGATTATACATTTTGTCCAAGTCTCTCAGCAGAACTAATTCAGCCAGGTAAATGG

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198711