An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT011425.2

General info


NONCODE TRANSCRIPT IDNONBTAT011425.2
NONCODE Gene IDNONBTAG007652.2
Chromosomechr2
Start Site89373614
End Site89374072
Strand+
Exon Number1
CNCI Score-0.0040960
Length458
AssemblybosTau6
Other transcript VersionsNONBTAT011425.1(old version)

Sequence


>NONBTAT011425.2
TGATTGAAAGGCAGTATTTATACTTACATGGAAAAATTTCAGATGTGTGGATTGGGTTTTAAATTTCTCTGATGTGGAAAAAAAAGAGCAGATGGCAGCTGCAGACCCAACTCATTACCAAGCCTTCTTCTTAGAGGTTAAATGGGAAGATGGTCTCCCTAGCCTAGGAGACTCAGGCCTCCTGTGGGAATAGGTGCCCCTGGGCCTTCCCTTCACCCAGTCATTGCACTTCTCTCCCCTGGAGGAGCCCTTACGCAGAGCCATGCTTGTGGTTTCAGAGGAAAAGAAAGGGAATGGGGAGGAGAATCAAGAGAAAATTGTTTCTTCTTATTTCTTTTCAAACATATTGCAGAACAAAGCCGGGCTGATGTTTAGCTGGTGGGACACTGATGCCACAGGCAGGCCAGGGTCTGTCCTGACAGGTCCCTTGTCTGTTCTCATTGGCTGAAGCCTGTACC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH199410