An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT012228.2

General info


NONCODE TRANSCRIPT IDNONBTAT012228.2
NONCODE Gene IDNONBTAG008208.2
Chromosomechr20
Start Site15514038
End Site15514635
Strand-
Exon Number1
CNCI Score-0.0004096
Length597
AssemblybosTau6
Other transcript VersionsNONBTAT012228.1(old version)

Sequence


>NONBTAT012228.2
TCTTATTACTGACTGCCCTTCTCCTGATCTGCTTGCCCATATCTGGTTCTATTAATCTTTTCTACATAATCATATCCAATATGTTTTTCTGCTTTTTTCAATAAAGGAGTCTTAATCAATGATAATTATAATTCTCTAATTAGTTTCTTAATAACATTTTTTGTAGAAGAGTACAGAATTCTGGAAACACTTTTCAGCAGTTAGAAATATTTTTGCAAAAAAAAGAAAAAAAGCTCAAAGCATCTTACTTGCCGTTTTATATTCATACAGTATATTTTTAGTATTAATTGAGTTGGCAGATCAAGTTTATCCACACTTTCCACGCTCTTTAAGTTTCGTTAATGTCTTACCATCCTTTAGCATATATTTATCTGCAACCTCTCACACCTGATTAGGTTCAATCAGTTGTCTCTGAATATTTAATACTACTCTGTTACTTCGTAGTGCTTAGTTCTCTTTTTAAAATGTTATTGACCTATGCGTGCATGGCCAGTGAATTGACAAATTTTTACCCAAATTTTTAGAGTTAATTGTGTTAGACATGCTTGGGGGAATATGCTGAGTGTCTGCCTTTTTCTCTGAAAGTTATCTTTGTTT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH199843