An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT015449.2

General info


NONCODE TRANSCRIPT IDNONBTAT015449.2
NONCODE Gene IDNONBTAG010248.2
Chromosomechr25
Start Site6101780
End Site6102135
Strand+
Exon Number1
CNCI Score-0.0004096
Length355
AssemblybosTau6
Other transcript VersionsNONBTAT015449.1(old version)

Sequence


>NONBTAT015449.2
TCACCAGTTTCCAGAAAGACTGGTGGACTCAGATTCCAGATCCTGTGTCTGAGGCTGTGTGGAGCAGTAAGTAGACTACACTGTTCACAAAGAGCTGGTTTCTAGTTCCAGTTTTCTCAGGATTCACATGAGGTTGGACTATTTGGGGTGGAGGTGGGGGGAAGAAATCTTTGTATGCCTTAATGCTCTCATCTGTAAAGCAAGGCATCCAAATCACATAAATTATGAATTACCTTTCATTTTTATAATTCTGCATCCCACAATTGAAGTTCATTGGTAGGAATCAGTAATTTCATATTTTGCCTCATTTCCTTAAAATCCACATTCCTCGCAGTAAGTTTACCCACACTAGGGC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH197478