An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT016264.2

General info


NONCODE TRANSCRIPT IDNONBTAT016264.2
NONCODE Gene IDNONBTAG010769.2
Chromosomechr26
Start Site36318204
End Site36318802
Strand+
Exon Number1
CNCI Score-0.0004096
Length598
AssemblybosTau6
Other transcript VersionsNONBTAT016264.1(old version)

Sequence


>NONBTAT016264.2
CATTTAAGTTATGCAGTTTTTTTTAAAGTATGTAGTGTGATTTTTTTCACTTATTGTCACTTTAATATAATGTCATGATCATTTTAAGTCAGTAGTCCTACTGAAAGAGTAAAGTTTTGGTATTTGTATTTATTCATGCCTAGTTAAATTTAACAGCAACATGAAATAAATGATTACCTGTTTGGATATAATTTCATAATAAGGCCTCTGAAGGTCGTTTGAAATACTGCACTAATTAATGTTTTATTTCCAGCCTTCCTTAATTATTCTAGCCAGATGGTCCTTTATTTATGTTATTGCTAGAGGTTTCCAGCTGAGGTTGTTTGATTGTTGAAGAAAAATATGTGATGGCACCATAAGATAACTGTAATTGAATTGTTAGGTATGTTCGAGCATTCACGCCTTCTGTCCCTGTTTTAGCCACATCTGGGAAATAAGTTTGTTAACAAAGCACTTTGACACCTCATCTGATAACTTGAGTGGAATTCTGAACTGTGCAGAAGGAATTCAGATGGGAAAATGACTCTGCGTTTATTGTAAAAGGATACACTTTGCAAACATCTCTCTGTGCAAAATTTGTTTTGTGGATGATAGGAAA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198471