An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT016430.1

General info


NONCODE TRANSCRIPT IDNONBTAT016430.1
NONCODE Gene IDNONBTAG010881.1
Chromosomechr27
Start Site6360651
End Site6361025
Strand-
Exon Number1
CNCI Score-0.5831937
Length374
AssemblybosTau6
Other transcript VersionsNONBTAT016430.2

Sequence


>NONBTAT016430.1
CTAGCGAATCTTAGAAACTCTACCTTTTCAGACCAAATATAATCTGGCATAGGTTTAGGAATATAAACATAAAGTCCTTAAGGGAAAAAAATGAGTGTGAAAAGGGTTCATGCTCCAAATGGAATCATGTTTCTGACATGTCTGTTTTGAGCATCGGAAGTTTGATTCTAATTATGATAGGTTTCACATTTCAGAAACTTATCTGTAAGAATATAAATCTTTAATTCTGATCTTTCAAGAGGCCACACCAGGTTGGTTGAGAGTGATTAGGTCATAGTATTGTCTGACATATTCAGGTTAACACATAGGCGACTTGCAAAGATATACATAAGAAATTAACAAAACAACTTCAGATACTTTCTCACTAAGGAATC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH199020