An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT016430.2

General info


NONCODE TRANSCRIPT IDNONBTAT016430.2
NONCODE Gene IDNONBTAG010881.2
Chromosomechr27
Start Site6360651
End Site6361025
Strand-
Exon Number1
CNCI Score-0.0004096
Length374
AssemblybosTau6
Other transcript VersionsNONBTAT016430.1(old version)

Sequence


>NONBTAT016430.2
CTAGCGAATCTTAGAAACTCTACCTTTTCAGACCAAATATAATCTGGCATAGGTTTAGGAATATAAACATAAAGTCCTTAAGGGAAAAAAATGAGTGTGAAAAGGGTTCATGCTCCAAATGGAATCATGTTTCTGACATGTCTGTTTTGAGCATCGGAAGTTTGATTCTAATTATGATAGGTTTCACATTTCAGAAACTTATCTGTAAGAATATAAATCTTTAATTCTGATCTTTCAAGAGGCCACACCAGGTTGGTTGAGAGTGATTAGGTCATAGTATTGTCTGACATATTCAGGTTAACACATAGGCGACTTGCAAAGATATACATAAGAAATTAACAAAACAACTTCAGATACTTTCTCACTAAGGAATC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH199020