An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT019918.2

General info


NONCODE TRANSCRIPT IDNONBTAT019918.2
NONCODE Gene IDNONBTAG013278.2
Chromosomechr4
Start Site76863955
End Site76864702
Strand-
Exon Number2
CNCI Score-0.0655360
Length391
AssemblybosTau6
Other transcript VersionsNONBTAT019918.1(old version)

Sequence


>NONBTAT019918.2
TTGGCTGGGGAAGCCCCGGATCTCTTGTGATTACAGATGGCTCCTATTCTTCAGCCACAAATAATGACTGTCCATGTAGTTATTAATATAATCCTTCATTCCTTTGTGAAATCCCTGTACTTCCCTAGATTCAGTTTGTTCTACACTAATAACCACAGGGAAATGGTAGATCACTCCTCTGTGCAGTTAAACTACATCTCCGGTGGACTTTTCATGTGACCACAAACTAAGGAAACCATCATGACTAAGACCCACGTCTAGCTCGGTAGGTGACGGAGCATCTTACCTGGGCTTCACCCCGCCCACCTCCAAACACTGCAATCCCTGCCCTGTCTTGTCATCCTTTCTGTCCTAAACCTGAATCCTGCAGTACCGTCTGCCATTGTGTCTT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH199237