An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT020868.2

General info


NONCODE TRANSCRIPT IDNONBTAT020868.2
NONCODE Gene IDNONBTAG013926.2
Chromosomechr5
Start Site42676427
End Site42677187
Strand+
Exon Number1
CNCI Score-0.0004096
Length760
AssemblybosTau6
Other transcript VersionsNONBTAT020868.1(old version)

Sequence


>NONBTAT020868.2
GGTCACATTAATACAAATGTCTTAGTGCCAAGATCAGTTGTTTCAACATTGTGGGGAGCATTTTTGACTATATGTTGTAGAACTGGTTCCATAGTGTATGAAACTGTCACTTAGACTGTATTCTCTTCATAAGTCTATAAAATTACCATACATTTTATTAACAGATGTGTAATTATTAGTTTCTCTTGTCTGTGGCAAAGTTGTAGTGTTTCTTGTTCATATAGTTATTAATTCTGCTTTACAAGAAATTAAATTTTGCCCTGATCTATTAGGCCATTGGTTTGTCCACAATGTATTCAAACTTTATTATTATAGAGTCCATCAGGTACTGATTTTCATTGATAATCAGCAGATATTTCATTGAAATAATTTTTCTGTGATTTACTTGATGATTTTTTATAAACTGTCCTCTATGAGCTTCTTCATTACTCATACCATAATGCTTCTTCATTACTAGATATGACCATTATACTAGTTATGTACTAAAAGTCATAAAACATATTCTATTGAGAATGTCATCAAGATACTCAGAATGGGAGAACAAAATGGAAAAAAAGAGAAAATATAGTAGTAAAATTCTCCTGTTTATTTCTAGTATTATTTGGTGAGAATTCTGCAGTAGAGTACAGAAGATAAGTACTAGAATATGTTCTCATTACATGCCTAATTTTTGTCTTTGTTTTTTATATCACCAATTTAACATGTATTAAAGACCTAGAACTATAGCTTTGTCAAAAAGTATTTCTTTTCTTCCATTGCA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198030