An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT022347.2

General info


NONCODE TRANSCRIPT IDNONBTAT022347.2
NONCODE Gene IDNONBTAG014922.2
Chromosomechr6
Start Site67265701
End Site67266019
Strand+
Exon Number1
CNCI Score-0.0004096
Length318
AssemblybosTau6
Other transcript VersionsNONBTAT022347.1(old version)

Sequence


>NONBTAT022347.2
CTAGCTGTTCCTTCTTATTAAAGAGGTAGCTCCTAATCATCAAAGAGGAGCTTCAACCATGCAACTCTCTGTCTCCCATCGAAAAACATGGTGGTCTGAGAGTGGCCACCCCCAGAAGATTTCACATCTATTGAGCTCTAATCCAGTGTAGGTCTCAACCCAAACTGTTCCCAGGATTGGATACCTATGGTGTGTTCGTTGTTTCCTTCCTTCATACATACATAGATGCCACAGTGAATGCTATTATAGGCATTAAAATTGACATAAGAACACCTCCTCAAAAAACTAAAATGAGTTTAATTGTCTAAATAATACCCC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH199187