An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT023437.2

General info


NONCODE TRANSCRIPT IDNONBTAT023437.2
NONCODE Gene IDNONBTAG015608.2
Chromosomechr7
Start Site59798291
End Site59798946
Strand-
Exon Number2
CNCI Score-0.0004096
Length212
AssemblybosTau6
Other transcript VersionsNONBTAT023437.1(old version)

Sequence


>NONBTAT023437.2
CCCTGTCATCAATTACTAGCACCTCGCCTGAGCAGGGAGATACACAGGGCATAGTTCTAGGTGTCTTCATACATCTATCGGTTGATCTCAAGCATGTTTCCAGGAAGAAGAAGCTGTAGCCTTAGGTATTAATATAATGAACCACTTTCACATTTTCCTATAGAATCCACATGCTTCTTGTGTCTGAGTCTTACCTTTTTCTCTCCTCTGAT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198120