An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT023600.2

General info


NONCODE TRANSCRIPT IDNONBTAT023600.2
NONCODE Gene IDNONBTAG015705.2
Chromosomechr7
Start Site75099328
End Site75100011
Strand-
Exon Number2
CNCI Score-0.0004096
Length423
AssemblybosTau6
Other transcript VersionsNONBTAT023600.1(old version)

Sequence


>NONBTAT023600.2
GTTGGAAAACAAAAGGAATAAGCTAATATGTTTTATTTCCTTCATTAAACCAATGTATGAATATTTTTAATTTGGCAGCCGACAAATCAACATATTGAAACAAGTAATACAGGGTACTGAGCATTTCTCTATCAGCGAATCAATGCCTACAGTTCTTATGAACCACTGCACAGTTTGACACTCTAATAGTACTGTACCTCAGAACATGGAAATCAACTAGTTCTCACATTGCTTGTCTACTTATTCTCTTTTTCAAGGAAACAACTAGCATTGTTCAATGGTGATTTAAAAGCAAAAATGTCTTAAGAAAACAGAAAATGTTGCTGTGTTATTATGTAAATAATTAAACATGCTGTAAATGAATAGTCAATAGATACAAATCATTGTTTAGTTTTTTTTCTTTTTTAGTTTTTATTTAATTTT

Isoforms

Transcript ID
NONBTAT023601.2

Data Sources

Source NameOld Id
PMID22880061EH198215