An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT023603.2

General info


NONCODE TRANSCRIPT IDNONBTAT023603.2
NONCODE Gene IDNONBTAG015707.2
Chromosomechr7
Start Site75130308
End Site75130760
Strand-
Exon Number1
CNCI Score-0.0004096
Length452
AssemblybosTau6
Other transcript VersionsNONBTAT023603.1(old version)

Sequence


>NONBTAT023603.2
ATAAAGTTCTTCATAATAGTATCATTTCACATCTTGGATACATTTGAGTTATTTAATAAATAGCAGTGACAACTGATGACCATTGGGGGATGTTTAAATATAGTACCATTTAACTAACCCACCCTTTCCTCTAACTTGTAGCTGTATCTAAGGTCCCAGGTACAACACAAGTAACACAATCATTACTGCATTATTTTGATTTTGCTTTCTGTTTTTGTAGTGGCTACATTTGGAGGATATAGGCTAGTAGGAATACTTTCTTTCACTTTATATCTTTCTATATTGTTTAAACTGTTACGAGTATATATTACTTTTTAAATTTAAGAAAGTTTATGTATGTGTATGTATACATATTCTTATCTGATTTGCCAATATGATCCTATAATCTCCTATAATCCTTTATTATATTCTCTCTCTCACATGCAGACAAGCTCCCCATACCTTCCACATCG

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198303