An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT024454.2

General info


NONCODE TRANSCRIPT IDNONBTAT024454.2
NONCODE Gene IDNONBTAG016323.2
Chromosomechr8
Start Site53654907
End Site53655542
Strand+
Exon Number1
CNCI Score-0.0004096
Length635
AssemblybosTau6
Other transcript VersionsNONBTAT024454.1(old version)

Sequence


>NONBTAT024454.2
CTCCTCTTCTTAAAAAGTCAGATAGTAATCAGATTTTGGTTTTGTTTTTTGCTTAACTGTATTCCTATCTTTGCCTAATTTTCTTAAATATATTTATACTGAATATTATCACCTTGTATTTGGGATTTAAAGCCTTCCACGTTAATGAGTTGTTCCTATCATCTGCCTTTTCATATTTTGCTTTTTTCTTTCAGAAATGTTTTTGTTATAGAACTCTGCTACTTCATAGCATTTGGATGGTTTGAAAGTATTAGCTGTGTTTTCTATATTACTGTAGTTGTTAGGTATGTTCTTTTTCTAAAGTACTGGAACTTATCTGGCAGGAAATACAGATTTAGTAGAGAATAACTGATACAACTGCCTATCCAGTTCCTACTTTTTGTGTGTTTCTAATGTATAGTCAATTTGGTTTGGATTTTTTTTGTATCTAGCAAACTAAGGTTTACATACACATCTTTTCTATCGTAAAAGGAACCCTTACCAATAACCATACATTTTAATTGTTACTGTAGGTTCTGACAATTATATACAACAAATGCAGTTTCCTTAGTGTTTCTGTTTATTTCGTTAAGAAAATACTTAAATGATGATGGATAATTCATATATTCTATTAATGAGTAAGGCAAAAAATCCTT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH198281