An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT025511.2

General info


NONCODE TRANSCRIPT IDNONBTAT025511.2
NONCODE Gene IDNONBTAG017048.2
Chromosomechr9
Start Site54693316
End Site54693643
Strand+
Exon Number1
CNCI Score-0.0004096
Length327
AssemblybosTau6
Other transcript VersionsNONBTAT025511.1(old version)

Sequence


>NONBTAT025511.2
TATTTTTATCCTGCCATTATTAATACCTATTAATATCTTTTTTTCCTGAAGTGATTAAAATAAAGATTCTAGATTTATGTCTTGGTTGGTTTAATTTCAATATGATATATATACATGTATATATATTTTCCAGTAGAATCACATCAGTGTTATATTTCAGTATTGATATTCTTTTTAAAAGCACTTTTACAAGCTGATTTTTAATTCATATATGTAAATGTGTTAGTTTTCTGCCTAATACCTTTGATATTCAATAACTTCATCATAACTTTTCTTTTTGGAACAACACTATTTTTTTCCTAATAAACTCAGCTCTTGTTTACTCTG

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH196016