An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONBTAT027053.2

General info


NONCODE TRANSCRIPT IDNONBTAT027053.2
NONCODE Gene IDNONBTAG018004.2
ChromosomechrX
Start Site136032618
End Site136033213
Strand-
Exon Number1
CNCI Score-0.0004096
Length595
AssemblybosTau6
Other transcript VersionsNONBTAT027053.1(old version)

Sequence


>NONBTAT027053.2
CCTTGTTTTTAAAACAGCCTCCTGAGCTATGTTCTTTACAATGTCTGTAATTAGTGTTTCACCTGAGAAATCCTTTTGTGGTCATAAATAATTTCTACTTATTGAGAAAACAACAACAACAATACATACCAATCACAAAGAACAGGTTTCTACTTTATTGTCTGTGTAAGTGTGCATTTTAATATTCTTTTTCTTTCCTAGATGCAATTTGGGGATTTGAATTGTATATTGTGAAACTGATTTGATCATATACCCTCTTGAAAATGAATGCCCATTTTCTTTTAGATCCAAGTTAGCACACAACAGTTTTTTTCTGCTTTGCCTATATTTACGTGCAATTAAGTGCTCAAGCGTGACCTAGCCATTGCAGCCTCTCAGCCACAGTATTTATGAAGATGATGTGTCCTGAACGATGTAGCTCATATTAGCCTGAATTTCCCATTTCTGCTTTCATTGTAGGTGTAACTCTTAATCTTAATGTCAACTGACCCATGATTTCTACTGTCAATCCAAGTGAATATTGTTTGAAATATCTTTAACTAATTTGAAGAATTTTAAAGTTGTACTGTGATTTTCATAACCTGTTTCCTTTTTG

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22880061EH196084