An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONCELT003346.2

General info


NONCODE TRANSCRIPT IDNONCELT003346.2
NONCODE Gene IDNONCELG000714.2
ChromosomechrIII
Start Site2641871
End Site2642087
Strand+
Exon Number1
CNCI Score-0.2338816
Length216
Assemblyce10
Other transcript VersionsNONCELT003346.1(old version)

Sequence


>NONCELT003346.2
cctaagcctaagatttagccgaagcctaagtatatgcctaagtctaagcctacgcctagacctaaacctaggtctacgcctaaaccgaagccaaagcctaagcctagtcgttagcctaaacctacgtctaaacctaagcctaagactaaacatatgcctaaacttaagcctgaacctaagcctaagcctaagcctaaacctaagcctaagcctaag

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblH19M22.8