An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONCELT003347.2

General info


NONCODE TRANSCRIPT IDNONCELT003347.2
NONCODE Gene IDNONCELG000715.2
ChromosomechrIII
Start Site2641871
End Site2642090
Strand-
Exon Number1
CNCI Score-0.1204224
Length219
Assemblyce10
Other transcript VersionsNONCELT003347.1(old version)

Sequence


>NONCELT003347.2
atgcttaggcttaggcttaggtttaggcttaggcttaggcttaggttcaggcttaagtttaggcatatgtttagtcttaggcttaggtttagacgtaggtttaggctaacgactaggcttaggctttggcttcggtttaggcgtagacctaggtttaggtctaggcgtaggcttagacttaggcatatacttaggcttcggctaaatcttaggcttagg

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblH19M22.6