An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONCELT024020.1

General info


NONCODE TRANSCRIPT IDNONCELT024020.1
NONCODE Gene IDNONCELG000041.2
ChromosomechrI
Start Site3703541
End Site3704956
Strand+
Exon Number4
CNCI Score-0.0409600
Length465
Assemblyce10
Other transcript VersionsNone

Sequence


>NONCELT024020.1
CGACCGCCGTGTCGAGCAGCGCTGAGACGATGAATGAACACAGCGATATTGGAAATTCGCTTCAGTTTTCAAGGATTTCTTTAAAAACAGAAAATTGAGCGATTAGCGCCAAGAAGCGTCGGATGCCAGCTCCGAATCGACAAAAATCCACGGAATTTCAACAAAGTTCAATCGACTCTTATTTCAGCATCAATCAGAAGACTACGCCCTGGACTCCAAATCGATGAGTCGATGTACATTTGGGACGGAGCAGACCAAATGGACGACCACTACAATTCGAGAAGTTTTCGAATCGATAAGAAAGACGAGGATACTCCGAAAATGATCCCAGATTAGCCAATCGGAAACGCCACGGAAATCCATCTACAGAACAAACAAGTGCAGCAGAGACAGCGGATCGAGGGAAAATCCCGAAAAAATCTAATTTTTTTGCATTTTTTGAAATTTTGCTTAAATAAATTTTAT

Isoforms

Transcript ID
NONCELT024021.1
NONCELT000229.2
NONCELT000230.2

Data Sources

Source NameOld Id
ensemblF21A9.3