An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDMET003692.1

General info


NONCODE TRANSCRIPT IDNONDMET003692.1
NONCODE Gene IDNONDMEG001166.1
Chromosomechr2L
Start Site3478425
End Site3479618
Strand+
Exon Number2
CNCI Score-0.0204800
Length415
Assemblydm6
Other transcript VersionsNone

Sequence


>NONDMET003692.1
ATACCGCCAGCAATCGCCTAGCGAACAGCCAACGGTGAACACATAGCAGCCACACAAGCTCTATAGCTGATACAAGCAACGAAATACAAACAACGCAGTTTGTGTAAACAATCAAATTGTCGCAGCCATATCGAGTGTGCTTACACGTCCAGCGGAAAGTTTTCGAAACCAATCCAATCAATCAGCTAAGGGGGTGTGGCGTGTACACCGCCATGCAGCAACTGCCAAATCCAACTAGTTCTTAGATGCACCCACTAAAACCGATCTTATAAGCTTAGTGTACCCATTAACTAGATGCTAAGTTCTTAGTTCTTCCACCTTGTTTGTTCTCTCGGTCATATTGACCCCGTTACCTTGTAAAATCGTAGATCTTAAGTAAAATGCAATAAAAAAAAGGCACACATTATTTAAAAGA

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID24670639Thor.a