An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDMET027050.1

General info


NONCODE TRANSCRIPT IDNONDMET027050.1
NONCODE Gene IDNONDMEG008111.1
Chromosomechr3L
Start Site14103992
End Site14107197
Strand-
Exon Number2
CNCI Score-0.1392640
Length384
Assemblydm6
Other transcript VersionsNone

Sequence


>NONDMET027050.1
AGGCATATCTATTGAATACCATTTCCGTTGGCATTTCAGAGCTCGAGGAGCAGCTGCAGCACTACCACCTGATAATTACCACCTGCACCCCCATTGGAGTCCCTTGACTCCGCGCCCGGCATCCCGACTCCATTGCGCTTCGGCGCCGGCACCTCCTCATCCGCGGAACACGTGGTCTAGGATGAGCACCACAGAGGGAATTTGGATGGTAAACTTTACCATTCCTCTCCAAAAGTTAAAAGTCCTAATGTTAGAGCCTAGTGTTAGACGAATATTAATGCACGTCTTTAGTTGCTACTATAATTATGTTTTTGGTTCTGATTTAGTGCTGCTTCACTATTTTAGATGATTAATTTTAAAACTACATTCAAAATCTCAATTTAC

Isoforms

Transcript ID
NONDMET027048.1
NONDMET027049.1

Data Sources

Source NameOld Id
PMID24670639Sox21a-RAgin