An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDRET002450.1

General info


NONCODE TRANSCRIPT IDNONDRET002450.1
NONCODE Gene IDNONDREG001139.2
Chromosomechr13
Start Site35357785
End Site35396344
Strand+
Exon Number5
CNCI Score-0.0409600
Length807
AssemblydanRer10
Other transcript VersionsNONDRET002450.1(old version)

Sequence


>NONDRET002450.1
AATGAGCGATTCGTTTTCGTTGTAAACATTGTTTAATCGTGGTTGGTAAATTCTGAGGTCTGAAGATACACTAATCTGGCTCAATGTCCATAATTGACGACTGAGGAGTATTGAGATTACCTTTGGAAGTAGTGCAGGCAGAAGGTCCAGAGCATCAGGTGTTTCCCAGTGCCGTGGTTTCCATCGGTGGTCATCATCAAAAGCAAGGGCACCAGTAAAGCTGGAATCTCCTGGAGGAACCACGCTAGCCTTGCGGGCACCATCATGGAGCTGCCCGAGGTGTCCACGTAGCGGCCATAGGCAGCGTGAGACTTCATGAGACAAATAAAGTGCATTACCCCACCCAGGATCATCCCTAAACTCAGGCCCCGCACGAGGAGCTCCTGACACTGCATTGGAGGTCGAGTATCCGTCCGTTTTCAAACCAGGTATGAGCCTAATGCTGTATCTCCCCTCTTAACCCCTCAGCAGATTTGCGCAAACACAGCGTCTAAAAGCAGCTCCTCCCCAAAAAAAAGCAAGGCGAGAGTGGAGTCCTGACCGTGCTACAGCTTGCTGAAATGATGGAGGTTGTTACCTGCTGAAGGCACGATCATATATATTTATGCTCCAAAAGATTCAACAGAGCTAAAAAAACTTAAAGCGTGCAAATGGACACACACCCCAATGGCAGAAGTCAGAGGAAATGATGAAGAGATTGGAGGGGTCAGCCAGGTCGTACAGTGGCGTTCTGTAGACCTCGGCGGGGGAGAGGGCACAGCGAGACAGCGGCACGTGGTGAGAGGGGCCGAGAATGAACACCCTCCG

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENSDART00000132311