An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDRET002450.1

General info


NONCODE TRANSCRIPT IDNONDRET002450.1
NONCODE Gene IDNONDREG001139.1
Chromosomechr13
Start Site35705209
End Site35743768
Strand+
Exon Number5
CNCI Score0.0000000
Length807
AssemblydanRer7
Other transcript VersionsNONDRET002450.2

Sequence


>NONDRET002450.1
AATGAGCGATTCGTTTTCGTTGTAAACATTGTTTAATCGTGGTTGGTAAATTCTGAGGTCTGAAGATACACTAATCTGGCTCAATGTCCATAATTGACGACTGAGGAGTATTGAGATTACCTTTGGAAGTAGTGCAGGCAGAAGGTCCAGAGCATCAGGTGTTTCCCAGTGCCGTGGTTTCCATCGGTGGTCATCATCAAAAGCAAGGGCACCAGTAAAGCTGGAATCTCCTGGAGGAACCACGCTAGCCTTGCGGGCACCATCATGGAGCTGCCCGAGGTGTCCACGTAGCGGCCATAGGCAGCGTGAGACTTCATGAGACAAATAAAGTGCATTACCCCACCCAGGATCATCCCTAAACTCAGGCCCCGCACGAGGAGCTCCTGACACTGCATTGGAGGTCGAGTATCCGTCCGTTTTCAAACCAGGTATGAGCCTAATGCTGTATCTCCCCTCTTAACCCCTCAGCAGATTTGCGCAAACACAGCGTCTAAAAGCAGCTCCTCCCCAAAAAAAAGCAAGGCGAGAGTGGAGTCCTGACCGTGCTACAGCTTGCTGAAATGATGGAGGTTGTTACCTGCTGAAGGCACGATCATATATATTTATGCTCCAAAAGATTCAACAGAGCTAAAAAAACTTAAAGCGTGCAAATGGACACACACCCCAATGGCAGAAGTCAGAGGAAATGATGAAGAGATTGGAGGGGTCAGCCAGGTCGTACAGTGGCGTTCTGTAGACCTCGGCGGGGGAGAGGGCACAGCGAGACAGCGGCACGTGGTGAGAGGGGCCGAGAATGAACACCCTCCG

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENSDART00000132311