An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDRET004596.1

General info


NONCODE TRANSCRIPT IDNONDRET004596.1
NONCODE Gene IDNONDREG002248.2
Chromosomechr19
Start Site20209461
End Site20210673
Strand+
Exon Number2
CNCI Score-0.1228800
Length836
AssemblydanRer10
Other transcript VersionsNONDRET004596.1(old version)

Sequence


>NONDRET004596.1
TTTGAGCGTGAGACGGGTTTAATAGTCGGCCATCGCTCGCGGAGTATCTTCTGTTTCCTCTGTTGGTGGTTTATTTTCAGAAGTCATCAATCAAACGCTCAGCACTTACGAACCCTCACCCTCTCATCCTTCCTCCTTTTGAGCACAACGTTCCAAGCTTGAGTCACGGGAGTCAGCAGCGCCATGTAGGGCCTCGGCATAGCTTAAATTGTGAAAGCCCATTGCACGCCAGTTGTCTAAAACCTTGGATGCTCGAAAAAATACCAACAAGAAAATTGTCCTTCCACAGGAATGGGTTAAGCCGGTATATTTTGCTTCTCACCAAAAGGCTCATCGGAGCTTCCCTACAGTGGTTTGTCTTGTAGACGAGGAGGTTCGCGCCGCCTGAGAACAGCACCATTAAACAGCTTTTGGATCAGGAAGGAGTACCACTACAGATACCTTAGCCGACCACGCCGTGTGGAAATAGTCACACTGCTCGAGCTAGCGGAACGCTAGGTCAAAGTCTGGTTCTAAAACCGACGAATAAAACATAAACGTCAAACCAAAACTATGGACATCTACAGAAAACTAGGCAGGAAAAATGTCGATGAGTGTGGTGCAAAGAGCGACGAGGAAGCCTTCATTTGTGGCCCAAGTCATGGCAGATTGGTCGTTGTGGACGAAGAGTCGAACTCATTTTAAAACAACCTGTCATCCATCGCCGGACAGCCCTGTAATGAAAACGACATGCACAATTTTAAATGTTTTCTAACAGATAAATGGAAAAGCATCTGAAAATTATTTTCAGTCAGTTACCAAATGCTCTGGAAAGGGGAACAATAATGCGCTATAGC

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENSDART00000145774