An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDRET007228.1

General info


NONCODE TRANSCRIPT IDNONDRET007228.1
NONCODE Gene IDNONDREG003773.2
Chromosomechr23
Start Site34052179
End Site34056901
Strand+
Exon Number2
CNCI Score-0.0999424
Length360
AssemblydanRer10
Other transcript VersionsNONDRET007228.1(old version)

Sequence


>NONDRET007228.1
GCTTTTCACACCAGCTTTTTGGCCTCAAAGAAGCTCTTGAGGTGCTTCATTTGCCAGATGCCGGTGATGATGAGGATGACGGTCTGAGCGATGGACCACCACAAAACACGCTGGTTCGTGCTCTCGCTCGTCATGCGGAAACGCTCCTCACGTCGTACCAGTTTTCCACCTGCAAACAGTGCCATCTTGGTGGAGTTGGAGTGGAGGCAGATTTGATGCTCTCCTGGTGTGTGTGAGGTGAAGGTAAAACGACCATCAGAGCCATACTGACGGGACAGGATAACCTGAAATAAAAACAAAGCAAAAACTACCTCAGGGTTCTTGCACATTTTTACTACTTAAACTCCATGACTTTTCCAT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22110045Zv9_00052195
ensemblENSDART00000154378