An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDRET007228.1

General info


NONCODE TRANSCRIPT IDNONDRET007228.1
NONCODE Gene IDNONDREG003773.1
Chromosomechr23
Start Site34290232
End Site34294954
Strand+
Exon Number2
CNCI Score0.0000000
Length360
AssemblydanRer7
Other transcript VersionsNONDRET007228.2

Sequence


>NONDRET007228.1
GCTTTTCACACCAGCTTTTTGGCCTCAAAGAAGCTCTTGAGGTGCTTCATTTGCCAGATGCCGGTGATGATGAGGATGACGGTCTGAGCGATGGACCACCACAAAACACGCTGGTTCGTGCTCTCGCTCGTCATGCGGAAACGCTCCTCACGTCGTACCAGTTTTCCACCTGCAAACAGTGCCATCTTGGTGGAGTTGGAGTGGAGGCAGATTTGATGCTCTCCTGGTGTGTGTGAGGTGAAGGTAAAACGACCATCAGAGCCATACTGACGGGACAGGATAACCTGAAATAAAAACAAAGCAAAAACTACCTCAGGGTTCTTGCACATTTTTACTACTTAAACTCCATGACTTTTCCAT

Isoforms

Transcript ID

Data Sources

Source NameOld Id
PMID22110045Zv9_00052195
ensemblENSDART00000154378