An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDRET008417.1

General info


NONCODE TRANSCRIPT IDNONDRET008417.1
NONCODE Gene IDNONDREG004421.2
Chromosomechr4
Start Site6407707
End Site6500061
Strand+
Exon Number3
CNCI Score-0.0016384
Length929
AssemblydanRer10
Other transcript VersionsNONDRET008417.1(old version)

Sequence


>NONDRET008417.1
GAAAATTAACGTTATCTCAACCATTCTTGCGTGGTTATATTGTGTATTTATTGTCGTATTTAGGACTAATAACTAAAGTAATTGCTATAAAGAGAGAGGGACATTGTCTTTGGTTTGAATTGACATTCAAATAAGGCTAATACAATTGGACCTTTTAAGGTTTTGGTACAAATGTGTTCAATAAACACTCGCTGCAACTCAACTGGGGGCCAGAAGAAAGCAGCAGAAACGCGCTGAAGATGTGTTGTGTCCCCCGCAGAGGCTCGGCTGCTCCACAAATAGCCTTTTCAAGTAAGTTGCGGCGGGCCGTGCTCTCTTCAGATCAAAGCCGAGGACAGAGAACATGGGCCGTGTCCATTACACGCACCTCTGGCTGCACGGACCATCTAAACAACGCTTGAGGTGCTGGGAGTCGGAACAAAACCATGGCTTTGGACTGCAAGGTCAATGAGGACAAACAATTCCAGCAGCGGCTCTCCAGCGCATGCAGAAGAAAGTGTGGGGCGAGGGGGGGGGGATGGACTCGTGCGCTGGCAGAGCTGGTGTCTCCGAGCGCTGGCATAATTTCCATGGCAACCCCTCTAACTATTAATTTTCAATTAAAGCAGACACAAAACGCCCTGCCCCGAGCTTGAGGAAGGTGTCAAGAGCGCAGAGCAGGAAACTGGGCCTTTCTGGAGCCACTCAGAGCCACTGGGCTCTTTCATAGTGACAAAAATCACACTGTATTTATTTCACCAAATCACACCAGTGATACACTCACATCCCAACTGAACACAAGCATGCTAAAAATTAGCCATGTTAGAATTTTTGGGGGGATTATAGCCACGTTTATGTCCCTTGGTGGTTTAGCAGAGGTGTTACCTCCCCCTTGTGTCGGCTTAAAATCTGACAGGATACTCAGCTGTCAATAAAAACCTGTTTTGAGC

Isoforms

Transcript ID
NONDRET008419.2
NONDRET008420.2
NONDRET008421.2

Data Sources

Source NameOld Id
ensemblENSDART00000144326