An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDRET008417.1

General info


NONCODE TRANSCRIPT IDNONDRET008417.1
NONCODE Gene IDNONDREG004421.1
Chromosomechr4
Start Site5805163
End Site5897487
Strand+
Exon Number3
CNCI Score0.0000000
Length899
AssemblydanRer7
Other transcript VersionsNONDRET008417.2

Sequence


>NONDRET008417.1
GAAAATTAACGTTATCTCAACCATTCTTGCGTGGTTATATTGTGTATTTATTGTCGTATTTAGGACTAATAACTAAAGTAATTGCTATAAAGAGAGAGGGACATTGTCTTTGGTTTGAATTGACATTCAAATAAGGCTAATACAATTGGACCTTTTAAGGTTTTGGTACAAATGTGTTCAATAAACACTCGCTGCAACTCAACTGGGGGCCAGAAGAAAGCAGCAGAAACGCGCTGAAGATGTGTTGTGTCCCCCGCAGAGGCTCGGCTGCTCCACAAATAGCCTTTTCAAGTAAGTTGCGGCGGGCCGTGCTCTCTTCAGATCAAAGCCGAGGACAGAGAACATGGGCCGTGTCCATTACACGCACCTCTGGCTGCACGGACCATCTAAACAACGCTTGAGGTGCTGGGAGTCGGAACAAAACCATGGCTTTGGACTGCAAGGTCAATGAGGACAAACAATTCCAGCAGCGGCTCTCCAGCGCATGCAGAAGAAAGTGTGGGGCGAGGGGGGGGGGATGGACTCGTGCGCTGGCAGAGCTGGTGTCTCCGAGCGCTGGCATAATTTCCATGGCAACCCCTCTAACTATTAATTTTCAATTAAAGCAGACACAAAACGCCCTGCCCCGAGCTTGAGGAAGGTGTCAAGAGCGCAGAGCAGGAAACTGGGCCTTTCTGGAGCCACTCAGAGCCACTGGGCTCTTTCATAGTGACAAAAATCACACTGTATTTATTTCACCAAATCACACCAGTGATACACTCACATCCCAACTGAACACAAGCATGCTAAAAATTAGCCATGTTAGAATTTTTGGGGGGATTATAGCCACGTTTATGTCCCTTGGTGGTTTAGCAGAGGTGTTACCTCCCCCTTGTGTCGGCTTAAAATCTGACAGGATACTCAGCTGTCAATAAAAACCTGTTTTGAGC

Isoforms

Transcript ID
NONDRET008419.1
NONDRET008420.1
NONDRET008421.1

Data Sources

Source NameOld Id
ensemblENSDART00000144326