An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDRET008421.1

General info


NONCODE TRANSCRIPT IDNONDRET008421.1
NONCODE Gene IDNONDREG004421.2
Chromosomechr4
Start Site6498754
End Site6500063
Strand+
Exon Number2
CNCI Score-0.0688128
Length858
AssemblydanRer10
Other transcript VersionsNONDRET008421.1(old version)

Sequence


>NONDRET008421.1
CTCTTTTCCTCATTCTCTATCCTGCATGCCACAGATGTTTCTCCTAGCTGCTCCCGCAGACAGGAATCCGCTCAGAGAGACGAGATCCACGCTCTCCCCCAGGAGACGAGTACAAAGGCCAGTCTGCGCGCGGCAGATGCAAAAAAAAAACCAAGTCCATCTGCTGTAGGCTTCCCATTGCCACATGGAGATTGAACAGTGAGGGTCACTGACAAGCGATTGCATAGGAACACCAGTGAGGAGCCAGCTGTGGGAGCAGACTTTAAATATAAAAGACTGACGTAAACACTTCTTGAATAGGACTTCACTCATACTCATATTCAATCGTAGAGCTCCTTACAAACACCCATCGGGGGCTTTGGACTGCAAGGTCAATGAGGACAAACAATTCCAGCAGCGGCTCTCCAGCGCATGCAGAAGAAAGTGTGGGGCGAGGGGGGGGGGATGGACTCGTGCGCTGGCAGAGCTGGTGTCTCCGAGCGCTGGCATAATTTCCATGGCAACCCCTCTAACTATTAATTTTCAATTAAAGCAGACACAAAACGCCCTGCCCCGAGCTTGAGGAAGGTGTCAAGAGCGCAGAGCAGGAAACTGGGCCTTTCTGGAGCCACTCAGAGCCACTGGGCTCTTTCATAGTGACAAAAATCACACTGTATTTATTTCACCAAATCACACCAGTGATACACTCACATCCCAACTGAACACAAGCATGCTAAAAATTAGCCATGTTAGAATTTTTGGGGGGATTATAGCCACGTTTATGTCCCTTGGTGGTTTAGCAGAGGTGTTACCTCCCCCTTGTGTCGGCTTAAAATCTGACAGGATACTCAGCTGTCAATAAAAACCTGTTTTGAGCAA

Isoforms

Transcript ID
NONDRET008417.2
NONDRET008419.2
NONDRET008420.2

Data Sources

Source NameOld Id
PMID22110045Zv9_00008326