An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONDRET008421.1

General info


NONCODE TRANSCRIPT IDNONDRET008421.1
NONCODE Gene IDNONDREG004421.1
Chromosomechr4
Start Site5896210
End Site5897519
Strand+
Exon Number2
CNCI Score0.0000000
Length858
AssemblydanRer7
Other transcript VersionsNONDRET008421.2

Sequence


>NONDRET008421.1
CTCTTTTCCTCATTCTCTATCCTGCATGCCACAGATGTTTCTCCTAGCTGCTCCCGCAGACAGGAATCCGCTCAGAGAGACGAGATCCACGCTCTCCCCCAGGAGACGAGTACAAAGGCCAGTCTGCGCGCGGCAGATGCAAAAAAAAAACCAAGTCCATCTGCTGTAGGCTTCCCATTGCCACATGGAGATTGAACAGTGAGGGTCACTGACAAGCGATTGCATAGGAACACCAGTGAGGAGCCAGCTGTGGGAGCAGACTTTAAATATAAAAGACTGACGTAAACACTTCTTGAATAGGACTTCACTCATACTCATATTCAATCGTAGAGCTCCTTACAAACACCCATCGGGGGCTTTGGACTGCAAGGTCAATGAGGACAAACAATTCCAGCAGCGGCTCTCCAGCGCATGCAGAAGAAAGTGTGGGGCGAGGGGGGGGGGATGGACTCGTGCGCTGGCAGAGCTGGTGTCTCCGAGCGCTGGCATAATTTCCATGGCAACCCCTCTAACTATTAATTTTCAATTAAAGCAGACACAAAACGCCCTGCCCCGAGCTTGAGGAAGGTGTCAAGAGCGCAGAGCAGGAAACTGGGCCTTTCTGGAGCCACTCAGAGCCACTGGGCTCTTTCATAGTGACAAAAATCACACTGTATTTATTTCACCAAATCACACCAGTGATACACTCACATCCCAACTGAACACAAGCATGCTAAAAATTAGCCATGTTAGAATTTTTGGGGGGATTATAGCCACGTTTATGTCCCTTGGTGGTTTAGCAGAGGTGTTACCTCCCCCTTGTGTCGGCTTAAAATCTGACAGGATACTCAGCTGTCAATAAAAACCTGTTTTGAGCAA

Isoforms


Transcript ID
NONDRET008417.1
NONDRET008419.1
NONDRET008420.1

Data Sources

Source NameOld Id
PMID22110045Zv9_00008326