An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT000776.1

General info


NONCODE TRANSCRIPT IDNONHSAT000776.1
NONCODE Gene IDNONHSAG000305.1
Chromosomechr1
Start Site9039636
End Site9039933
Strand-
Exon Number1
CNCI Score-0.2302688
Length297
Assemblyhg19
Other transcript VersionsNONHSAT000776.2

Sequence


>NONHSAT000776.1
gccaagtgcagtggtgcgtgcctgtagtcccaggtagctggaaggctgaggcaggaggatagcttaagcctaggagttctgggctgcagtgcactgtgccaatcaggtgtccacactaagtctgacatcagtatggtgacctccctggagcaggggacaaccaggttgcctaaggaggggtgaatcagcccaggtcagaaatggatcaggtcaaaactcctgtgctgatcggtaatgggatcatgcctgtgaatagccactgcactccagcctgggcaacataacaagatcctgtcc

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT000776
lncipedialnc-SLC2A7-1-1_dup1
ensemblENST00000583026