An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT001653.1

General info


NONCODE TRANSCRIPT IDNONHSAT001653.1
NONCODE Gene IDNONHSAG000702.1
Chromosomechr1
Start Site24890117
End Site24890465
Strand+
Exon Number1
CNCI Score-0.0996802
Length348
Assemblyhg19
Other transcript VersionsNONHSAT001653.2

Sequence


>NONHSAT001653.1
TTTAACGCAGCTTCCCATATTTACAGGAAGATTATGTCTTCTTTTTCCAAAGAGCTGAGACAGAAATATAATGTTCGGTCCATGCCCATCTGAAAGGATGAAGAAGCTCAGTTTGCACAAGGACACTATAGAGGTCAGCAAATTAGCAAAGTAGTCCAAGTTTATGGGAAGAAATACGTTGTCTGCACTGGACATATGCAGCGGGAGAAGGCTGGCCATTTGCCCCAGCAGGGCTCTTAACCCTGAACAAAGACTGAGATCCTTGAGCCAAAAGCTAAATCTCACCAAGTAGGAACAGAAAAGGCCAAATACAAGGAAAATGCAATTGGGAAGATGTAGGAATAAAGT

Expression Profile(Data Source:)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
NONCODEv4NONHSAT001653
ensemblENST00000443086
lncipedialnc-RCAN3-2-1_dup1