An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT001870.1

General info


NONCODE TRANSCRIPT IDNONHSAT001870.1
NONCODE Gene IDNONHSAG000797.2
Chromosomechr1
Start Site27200833
End Site27201473
Strand-
Exon Number1
CNCI Score-0.0737280
Length640
Assemblyhg38
Other transcript VersionsNONHSAT001870.1(old version)

Sequence


>NONHSAT001870.1
ATGGGTGGGACCACCAGCACCCGCCGGGTCACCTTCGAGGCGGACGAGAATGAGAACATTACCGTGGTGAAGGGCATCCGGCTTTCAGAAAATGTGATTGATCGAATGAAGGAATCCTCTCCATCTGGTTCGAAGTCTCAGCGGTATTCTGGTGCTTATGGTGCCTCAGTTTCTGATGAAGAATTGAAAAGAAGAGTAGCTGAGGAGCTGGCATTGGAGCAAGCCAAGAAAGAATCTGAAGATGAGAAACGACTAAAGCAGCCAAAGAGCTGGACCGAGAGAGGGTTGCTGCCAATGAGCAGTTAACCAGAGCCATCCTTCGGGAGAGGATATCTAGCGAGGAGGAACGCGCTAAGGCAAAGCACCTGGCTAGGCAGCTGGAAGAGAAAGACCGAGTGCTAAAGAAGCAGGATGCATTCTACAACGAACAGCTGGCTAGACTGGAGAAGAGGAACTCAGAGTTCTTCAGAGTCACCACTGAACAATATCAGAAAGCTGCTGAAGAGGTGGAAGCAAAGTTCAAGCGGTATGAGTCTCATCCAGTCTGTGCTGATCTGCAGGCCAAAATTCTTCAGTGTTACCGTGAGAACACCCACCAGACCTTCAAATGCTCCACTCTGGCCACCCAGAGTGGCCATGC

Expression Profile(Data Source:Human Body Map)

NA

Exosome Expression Profile(Data Source: NCBI GEO)

NA

Structure Visualization

No structure predicted!

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
ensemblENST00000446783
NONCODEv4NONHSAT001870
lncipedialnc-SLC9A1-3-1_dup1