An integrated knowledge database dedicated to ncRNAs, especially lncRNAs.

Detail infomation of NONHSAT004037.2

General info


NONCODE TRANSCRIPT IDNONHSAT004037.2
NONCODE Gene IDNONHSAG001870.2
Chromosomechr1
Start Site77645323
End Site77645616
Strand+
Exon Number1
CNCI Score-0.0491520
Length293
Assemblyhg38
Other transcript VersionsNONHSAT004037.1(old version)

Sequence


>NONHSAT004037.2
gctgggcacagtcacacatgcctatagtcccagctacttgggaggctgagggaggaggatcgcttgagtccaggagttctaagttgtagtgcactatgtcaatcaggtgtctgcattaagttcggcatcaatatggtgatctccagggagcagggtatgaccaggtcgcctaaggacggcagaatgggccaaggtcagaaacagagcaggtctaaacttccatgctgatcagtagtgggactgcacctatgaacagccactgcactccaatttgagtaaaacagaccctgtct

Expression Profile(Data Source:Human Body Map)

adiposeadrenalbrainbrain_Rbreastcolonforeskinheart
0001.293650000.138601
heart_RHLF_1HLF_2kidneyliverliver_RlunglymphNode
000000.86070700
ovaryplacenta_RprostateskeltalMuscletestestestes_RthyroidwhiteBloodCell
000000.90665600
Loading...

Exosome Expression Profile(Data Source: NCBI GEO)

A431_cellLine
(Squamous Cell Carcinoma Cell Line Exosomes)
BJ_cellLine
(Foreskin Fibroblast Cell Line Exosomes)
HepG2_cellLine
(Hepatocellular Carcinoma Cell Line Exosomes)
HUVEC_cellLine
(Human Umbilical Vein Endothelial Cell Line Exosomes)
invasive_NFPAs
(Invasive Non-functional Pituitary Adenomas Exosomes)
019.3733012.133116.5436
non-invasive_NFPAs
(Non-invasive Non-functional Pituitary Adenomas Exosomes)
MCF7_cellLine
(Human Breast Cancer Cell Line Exosomes)
MDA-MB-231_cellLine
(Human Breast Cancer Cell Line Exosomes)
tuberculosis_patients_serum
(Active Tuberculosis Patients Serum Exosomes)
normal_people_blood
(Normal People Blood Exosomes)
19.8891004.368430
Loading...

Structure Visualization

DataSource: show detail information

See experimental data visualization in DMS dataset or PARS dataset

Isoforms

Transcript ID

Data Sources

Source NameOld Id
lncipedialnc-AK5-3-1_dup1
NONCODEv4NONHSAT004037
ensemblENST00000470869